![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR5150 |
|||||
Accession | MI0018065 (change log) | ||||
Description | Oryza sativa miR5150 stem-loop | ||||
Literature search |
5 open access papers mention osa-MIR5150 | ||||
Stem-loop |
---- 5' guuugggggagcuucugacagcugcaguuucucuugu |||||||||||||||||||||||||||||||||||| u 3' caaacccccucgaagacugucgacgucgaagaggauc ggua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR5150-5p |
|
Accession | MIMAT0021098 |
Sequence |
10 - agcuucugacagcugcaguuucuc - 33 |
Deep sequencing | 1033 reads, 2 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Mature sequence osa-miR5150-3p |
|
Accession | MIMAT0021099 |
Sequence |
44 - agaagcugcagcugucagaagcuc - 67 |
Deep sequencing | 102 reads, 2 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
References |
|
1 |
PMID:21525786
"Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus"
RNA Biol. 8:538-547(2011).
|
2 |
PMID:22158467
"Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage"
Plant Cell. 23:4185-4207(2011).
|