Stem-loop sequence osa-MIR5150

Accession

MI0018065 (change log)

Description

Oryza sativa miR5150 stem-loop

Literature search

5 open access papers mention osa-MIR5150
(7 sentences)

Stem-loop

   ----                                      
5'     guuugggggagcuucugacagcugcaguuucucuugu 
       |||||||||||||||||||||||||||||||||||| u
3'     caaacccccucgaagacugucgacgucgaagaggauc 
   ggua                                      

Deep sequencing

1139 reads, 550 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (MSU7): Chr4: 18470790-18470868 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0018065

Mature sequence osa-miR5150-5p

• Accession: MIMAT0021098
• Sequence: 10 - agcuucugacagcugcaguuucuc - 33
• Deep sequencing: 1033 reads, 2 experiments
• Evidence: experimental; Illumina [1-2]
• Database links:
  • RNAcentral:URS0000246608_39947

Mature sequence osa-miR5150-3p

• Accession: MIMAT0021099
• Sequence: 44 - agaagcugcagcugucagaagcuc - 67
• Deep sequencing: 102 reads, 2 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS000006D706_39947

References

1. PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).
2. PMID:22158467 "Massive analysis of rice small RNAs: mechanistic implications of regulated microRNAs and variants for differential target RNA cleavage" Jeong DH, Park S, Zhai J, Gurazada SG, De Paoli E, Meyers BC, Green PJ Plant Cell. 23:4185-4207(2011).