Stem-loop sequence mmu-mir-5136

AccessionMI0018048 (change log)
Symbol MGI:Mir5136
DescriptionMus musculus miR-5136 stem-loop
Stem-loop 
   g     --    aag       uu a   -----   u uug 
5'  ggccu  uucc   ggugguu  c cgu     gag c   a
    |||||  ||||   |||||||  | |||     ||| |    
3'  ccggg  aagg   ucaucaa  g gcg     uuc g   u
   -     uc    --g       gg a   uauau   u uuu
Get sequence
Deep sequencing
48 reads, 0 reads per million, 26 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 8888699-8888774 [-]
intergenic
Database links

Mature sequence mmu-miR-5136

Accession MIMAT0020647
Sequence

47 -  

auaugcgagggaacuacugg

 - 66

Get sequence
Deep sequencing13 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).