![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-5136 |
|||||
Accession | MI0018048 (change log) | ||||
Symbol | MGI:Mir5136 | ||||
Description | Mus musculus miR-5136 stem-loop | ||||
Stem-loop |
g -- aag uu a ----- u uug 5' ggccu uucc ggugguu c cgu gag c a ||||| |||| ||||||| | ||| ||| | 3' ccggg aagg ucaucaa g gcg uuc g u - uc --g gg a uauau u uuu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence mmu-miR-5136 |
|
Accession | MIMAT0020647 |
Sequence |
47 - auaugcgagggaacuacugg - 66 |
Deep sequencing | 13 reads, 10 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21403133
"Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage"
Blood. 117:5340-5349(2011).
|