![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-5133 |
|||||
Accession | MI0018045 (change log) | ||||
Symbol | MGI:Mir5133 | ||||
Description | Mus musculus miR-5133 stem-loop | ||||
Stem-loop |
c ga ---- -u --- --a c 5' gcc gagg cuggagc gcggcag cgc ggc u ||| |||| ||||||| ||||||| ||| ||| 3' cgg cucc gacuucg cgccguc gug ccg g - ga uuuu cu ucu ccg g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-5133 |
|
Accession | MIMAT0020644 |
Sequence |
10 - gcuggagcugcggcagcgcag - 30 |
Deep sequencing | 182 reads, 49 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21403133
"Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage"
Blood. 117:5340-5349(2011).
|