Stem-loop sequence mmu-mir-5131

AccessionMI0018043 (change log)
Symbol MGI:Mir5131
DescriptionMus musculus miR-5131 stem-loop
Stem-loop 
   g     ---g   -    au  -g    u  cggaa      g    a  aa 
5'  gcggc    gcg ucgg  gc  cgug gg     gcgccg cggc ug  c
    |||||    ||| ||||  ||  |||| ||     |||||| |||| ||  u
3'  cgccg    ugc agcc  cg  gcac cc     cgcggc gccg gc  a
   -     gcaa   g    -c  ag    -  -----      -    g  cc
Get sequence
Deep sequencing
117 reads, 13.9 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 45657961-45658053 [-]
sense
OTTMUST00000059304 ; Ddhd1-009; 5'UTR (exon 1)
OTTMUST00000058469 ; Ddhd1-003; 5'UTR (exon 1)
OTTMUST00000058571 ; Ddhd1-002; 5'UTR (exon 1)
OTTMUST00000059303 ; Ddhd1-001; 5'UTR (exon 1)
ENSMUST00000051310 ; Ddhd1-009; 5'UTR (exon 1)
ENSMUST00000149286 ; Ddhd1-003; 5'UTR (exon 1)
ENSMUST00000087320 ; Ddhd1-002; 5'UTR (exon 1)
ENSMUST00000111828 ; Ddhd1-001; 5'UTR (exon 1)
Database links

Mature sequence mmu-miR-5131

Accession MIMAT0020642
Sequence

60 -  

cggcgccccacggagccccgagc

 - 82

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).