Stem-loop sequence mmu-mir-5120

AccessionMI0018029 (change log)
Symbol MGI:Mir5120
DescriptionMus musculus miR-5120 stem-loop
Literature search

1 open access papers mention mmu-mir-5120
(1 sentences)

Stem-loop 
   g    g   cuuu        gg      -c    g gac 
5'  agcu guc    ggggcugu  ugccac  agcu u   a
    |||| |||    ||||||||  ||||||  |||| |    
3'  ucgg cag    ccccgacg  acggug  ucga g   g
   -    a   acuu        --      ac    g uga
Get sequence
Deep sequencing
81 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 44607491-44607568 [-]
sense
OTTMUST00000097149 ; Pax5-008; intron 5
OTTMUST00000015563 ; Pax5-005; intron 6
OTTMUST00000015564 ; Pax5-006; intron 6
OTTMUST00000015402 ; Pax5-002; intron 6
OTTMUST00000097142 ; Pax5-010; intron 6
OTTMUST00000097144 ; Pax5-012; intron 6
OTTMUST00000097145 ; Pax5-014; intron 6
OTTMUST00000097146 ; Pax5-016; intron 6
OTTMUST00000097148 ; Pax5-009; intron 6
OTTMUST00000015561 ; Pax5-003; intron 7
OTTMUST00000015562 ; Pax5-004; intron 7
OTTMUST00000015403 ; Pax5-001; intron 7
OTTMUST00000097143 ; Pax5-011; intron 7
OTTMUST00000097147 ; Pax5-013; intron 7
ENSMUST00000172949 ; Pax5-008; intron 5
ENSMUST00000107827 ; Pax5-005; intron 6
ENSMUST00000107826 ; Pax5-006; intron 6
ENSMUST00000143235 ; Pax5-002; intron 6
ENSMUST00000134968 ; Pax5-010; intron 6
ENSMUST00000174319 ; Pax5-012; intron 6
ENSMUST00000173733 ; Pax5-014; intron 6
ENSMUST00000172866 ; Pax5-016; intron 6
ENSMUST00000165417 ; Pax5-009; intron 6
ENSMUST00000107825 ; Pax5-003; intron 7
ENSMUST00000102932 ; Pax5-004; intron 7
ENSMUST00000014174 ; Pax5-001; intron 7
ENSMUST00000173821 ; Pax5-011; intron 7
ENSMUST00000174242 ; Pax5-013; intron 7
Database links

Mature sequence mmu-miR-5120

Accession MIMAT0020628
Sequence

11 -  

uuuggggcuguggugccaccagc

 - 33

Get sequence
Deep sequencing60 reads, 15 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).