Stem-loop sequence mmu-mir-5110

AccessionMI0018019 (change log)
Symbol MGI:Mir5110
DescriptionMus musculus miR-5110 stem-loop
Literature search

1 open access papers mention mmu-mir-5110
(1 sentences)

Stem-loop 
   ----------------------------------ag   a  a        g  gu gaa 
5'                                     cgg gg gguagagg ug  g   u
                                       ||| || |||||||| ||  |    
3'                                     guc uc ccgucucu ac  u   u
   ugagucccguucaccgaucuuguugcaucgggacag   a  a        -  ug agu
Get sequence
Deep sequencing
56 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 85760616-85760702 [-]
antisense
OTTMUST00000002051 ; Bcas3-010; intron 1
OTTMUST00000002047 ; Bcas3-006; intron 8
OTTMUST00000002046 ; Bcas3-005; intron 9
OTTMUST00000002045 ; Bcas3-004; intron 13
OTTMUST00000002043 ; Bcas3-002; intron 23
OTTMUST00000002042 ; Bcas3-001; intron 24
ENSMUST00000130343 ; Bcas3-010; intron 1
ENSMUST00000092822 ; Bcas3-006; intron 8
ENSMUST00000142596 ; Bcas3-005; intron 9
ENSMUST00000154396 ; Bcas3-004; intron 13
ENSMUST00000092821 ; Bcas3-202; intron 22
ENSMUST00000108062 ; Bcas3-002; intron 23
ENSMUST00000074875 ; Bcas3-201; intron 23
ENSMUST00000108061 ; Bcas3-001; intron 24
Database links

Mature sequence mmu-miR-5110

Accession MIMAT0020618
Sequence

4 -  

ggaggagguagagggugguggaauu

 - 28

Get sequence
Deep sequencing54 reads, 30 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).