Stem-loop sequence mmu-mir-3473c

AccessionMI0018015 (change log)
Symbol MGI:Mir3473c
DescriptionMus musculus miR-3473c stem-loop
Gene family MIPF0001230; mir-3473
Literature search

3 open access papers mention mmu-mir-3473c
(69 sentences)

Stem-loop 
   c                    c  c     a   c  uua 
5'  ugcugagccaucucuccagc cc auaau agu uu   a
    |||||||||||||||||||| || ||||| ||| ||    
3'  augacucgguagagggguug gg uauua uua aa   a
   -                    a  a     c   a  ugu
Get sequence
Deep sequencing
1046 reads, 478 reads per million, 126 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 191998554-191998634 [-]
sense
ENSMUST00000085573 ; Traf5-201; intron 11
Database links

Mature sequence mmu-miR-3473c

Accession MIMAT0020614
Sequence

12 -  

ucucuccagcccccauaauaag

 - 33

Get sequence
Deep sequencing359 reads, 103 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).