Stem-loop sequence mmu-mir-5106

Accession

MI0018014 (change log)

Symbol

MGI:Mir5106

Description

Mus musculus miR-5106 stem-loop

Stem-loop

   c    ga  aa    aac   a   ac  g  a    a 
5'  acuc  gc  caac   agc aca  cc ag gccu u
    ||||  ||  ||||   ||| |||  || || |||| c
3'  ugag  cg  guug   ucg ugu  gg uc cggg u
   -    -a  --    -ac   a   cu  a  -    a 

Deep sequencing

114 reads, 27.9 reads per million, 43 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr4: 44221195-44221267 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000016063 ; Rnf38-014; intron 1

  OTTMUST00000016064 ; Rnf38-015; intron 1

  ENSMUST00000123844 ; Rnf38-014; intron 1

  ENSMUST00000153116 ; Rnf38-015; intron 1

Database links

• EntrezGene:Mir5106
• MGI:Mir5106
• RNAcentral:URS000075D250_10090
• miRBase Tracker:MI0018014

Mature sequence mmu-miR-5106

• Accession: MIMAT0020613
• Sequence: 49 - aggucuguagcucaguuggcaga - 71
• Deep sequencing: 100 reads, 40 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS00000BD6A9_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-5106
  • miRDB:mmu-miR-5106

References

1. PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).