![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-5103 |
|||||
Accession | MI0018011 (change log) | ||||
Symbol | MGI:Mir5103 | ||||
Description | Mus musculus miR-5103 stem-loop | ||||
Literature search |
2 open access papers mention mmu-mir-5103 | ||||
Stem-loop |
c u u - ua uc auaa a 5' uucugg ggucuu gggga ccc gga ugggc c u |||||| |||||| ||||| ||| ||| ||||| | 3' aggacc ccggag ccccu ggg ccu acucg g u - c u a -- -- -ggg u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-5103 |
|
Accession | MIMAT0020610 |
Sequence |
51 - ucauccgggauccccugagg - 70 |
Deep sequencing | 116 reads, 37 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:21403133
"Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage"
Blood. 117:5340-5349(2011).
|