Stem-loop sequence mmu-mir-5100

Accession

MI0018008 (change log)

Symbol

MGI:Mir5100

Description

Mus musculus miR-5100 stem-loop

Literature search

5 open access papers mention mmu-mir-5100
(13 sentences)

Stem-loop

   -  g  ag     -   --     ac    gag 
5'  gu gg  ggagg acu  uggga  ugaa   c
    || ||  ||||| |||  |||||  ||||    
3'  ca cc  ucucc ugg  acccu  gcuu   a
   u  g  cu     g   cg     aa    gag 

Deep sequencing

34230 reads, 85.6 reads per million, 104 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr11: 60728663-60728726 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000017730 ; Smcr7-001; intron 1

  OTTMUST00000017732 ; Smcr7-003; intron 1

  OTTMUST00000017731 ; Smcr7-002; intron 1

  ENSMUST00000018743 ; Mief2-001; intron 1

  ENSMUST00000154890 ; Mief2-003; intron 1

  ENSMUST00000146159 ; Mief2-002; intron 1

Database links

• EntrezGene:Mir5100
• MGI:Mir5100
• RNAcentral:URS000075DDA4_10090
• miRBase Tracker:MI0018008

Mature sequence mmu-miR-5100

• Accession: MIMAT0020607
• Sequence: 36 - ucgaaucccagcggugccucu - 56
• Deep sequencing: 34220 reads, 104 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS0000044E25_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-5100
  • miRDB:mmu-miR-5100

References

1. PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).