Stem-loop sequence osa-MIR5080

AccessionMI0017970 (change log)
DescriptionOryza sativa miR5080 stem-loop
Literature search

1 open access papers mention osa-MIR5080
(1 sentences)

Stem-loop 
   acacac    -   -  -  a      ac    aagaaacgugag 
5'       auac cug ca gg gugguu  uuug            u
         |||| ||| || || ||||||  ||||            u
3'       uaug gac gu cc uacuag  aaac            c
   -acuuc    a   a  g  a      ga    gaaguuacagga
Get sequence
Deep sequencing
13 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 2322020-2322108 [-]
intergenic
Database links

Mature sequence osa-miR5080

Accession MIMAT0020579
Sequence

59 -  

aaaaggaucauaccgugacag

 - 79

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).