Stem-loop sequence bdi-MIR5067

AccessionMI0017967 (change log)
DescriptionBrachypodium distachyon miR5067 stem-loop
Gene family MIPF0001200; MIR5067
Stem-loop
             g          u   c               a 
5' uacucccucc auccauauua uug cgcugauuuagugca c
   |||||||||| |||||||||| ||| |||||||||||||||  
3' augagggagg uagguauaau aac gcgacuaaaucaugu u
             a          c   a               u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 20615436-20615521 [+]
intergenic
Database links

Mature sequence bdi-miR5067

Accession MIMAT0020576
Sequence

55 - 

ucagcgacaacuaauauggau

 - 75

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).