Stem-loop sequence bdi-MIR5066

AccessionMI0017964 (change log)
DescriptionBrachypodium distachyon miR5066 stem-loop
Stem-loop
   -c      uu      u ua   gga    -      ---cuuu   uu   u 
5'   uuucug  gaagug a  agu   gugc cuagcc       cca  aga c
     ||||||  |||||| |  |||   |||| ||||||       |||  |||  
3'   gaagau  uuucac u  ucg   uacg gaucgg       ggu  ucu g
   ua      -u      - uc   aag    c      uugcguu   uu   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 55649102-55649202 [-]
intergenic
Database links

Mature sequence bdi-miR5066

Accession MIMAT0020573
Sequence

11 - 

aaguguauaaguggagugccu

 - 31

Get sequence
Evidence not experimental

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).