Dead miRNA entry

miRNA accession:
MI0017960
miRNA ID:
bdi-MIR5062b
Forward to:
MI0017959
Comment:
Two previously annotated MIR5062 entries map to the same locus in the v1.0 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence bdi-MIR5062b

AccessionMI0017960 (change log)
DescriptionBrachypodium distachyon miR5062b stem-loop
Stem-loop
   c     aug           g      -            a       g        u  ---------     uc  a 
5'  guagc   gugaaccuugg gaaaag ccgccuaacaug uuaaauu uauuuugu cu         acuau  ca a
    |||||   ||||||||||| |||||| |||||||||||| ||||||| |||||||| ||         |||||  ||  
3'  uauug   uacuuggaauc cuuuuu ggcggauuguac aauuuga augagacg gg         uggug  gu a
   c     gug           a      a            -       a        u  aauauaaca     uu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare [1].

Database links

Mature sequence bdi-miR5062b

Accession MIMAT0020569
Sequence

11 - 

gugaaccuuggggaaaagccgcc

 - 33

Get sequence
Evidence experimental;

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).