Stem-loop sequence osa-MIR5072

Accession

MI0017943 (change log)

Description

Oryza sativa miR5072 stem-loop

Literature search

7 open access papers mention osa-MIR5072
(14 sentences)

Stem-loop

   -----   gaaua a      ccc   cg    c     aaa 
5'      gcu     g ucgauu   cag  gagu gccaa   u
        |||     | ||||||   |||  |||| |||||    
3'      cga     c agcuga   guu  uuca cgguu   c
   uagca   ----a -      aca   uu    a     gug 

Deep sequencing

242 reads, 50 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context

• Coordinates (MSU7): Chr6: 17458695-17458770 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0017943

Mature sequence osa-miR5072

• Accession: MIMAT0020552
• Sequence: 12 - cgauuccccagcggagucgcca - 33
• Deep sequencing: 183 reads, 2 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS00002F6264_39947

References

1. PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).