![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR5072 |
|||||
Accession | MI0017943 (change log) | ||||
Description | Oryza sativa miR5072 stem-loop | ||||
Literature search |
![]()
7 open access papers mention osa-MIR5072 | ||||
Stem-loop |
----- gaaua a ccc cg c aaa 5' gcu g ucgauu cag gagu gccaa u ||| | |||||| ||| |||| ||||| 3' cga c agcuga guu uuca cgguu c uagca ----a - aca uu a gug |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR5072 |
|
Accession | MIMAT0020552 |
Sequence |
12 - cgauuccccagcggagucgcca - 33 |
Deep sequencing | 183 reads, 2 experiments |
Evidence | not experimental |
Database links |
|
References |
|
1 |
PMID:21352554
"Discovery of barley miRNAs through deep sequencing of short reads"
BMC Genomics. 12:129(2011).
|