Stem-loop sequence gma-MIR4997

AccessionMI0017863 (change log)
DescriptionGlycine max miR4997 stem-loop
Gene family MIPF0001334; MIR4997
Stem-loop
   ------------                        g    c          a           a                c                a  c                         aua        a     uau    uu  cauu         c  uu 
5'             aagcggggagacaucgcggcagaa aaau cugaucguca gcgcgaagaug ggucgaccaugugaca auucucacgucaucac ga aucauaaugaaugauuuucauguuu   uuuaaauu guugu   augu  gu    ugaauuuga ac  a
               |||||||||||||||||||||||| |||| |||||||||| ||||||||||| |||||||||||||||| |||||||||||||||| || |||||||||||||||||||||||||   |||||||| |||||   ||||  ||    ||||||||| ||  a
3'             uucgccccucuguagcgucgucuu uuua gacuagcagu cgcgcuucuac cuagcugguacacugu uaggagugcaguagug cu uaguauuacuuacuaaaaguacaga   aaauuuaa caaca   uaca  ca    auuuaaacu ug  u
   aacucguucauc                        a    a          c           c                a                c  a                         gac        a     ---    uu  ---u         -  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR4997

Accession MIMAT0021015
Sequence

33 - 

gaucgucaagcgcgaagaugagg

 - 55

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).