Stem-loop sequence gma-MIR4995

AccessionMI0017861 (change log)
DescriptionGlycine max miR4995 stem-loop
Stem-loop
   -uaaaac           g       u    gaa  ---c    ga 
5'        ucauaggcagu gcuuggu aagg   gc    acug  g
          ||||||||||| ||||||| ||||   ||    ||||   
3'        gguauuuguua cgggcca uucu   cg    ugau  c
   aagccca           a       c    gaa  aaaa    gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 38252864-38252953 [+]
intergenic
Database links

Mature sequence gma-miR4995

Accession MIMAT0021013
Sequence

11 - 

aggcaguggcuugguuaaggg

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).