Stem-loop sequence gma-MIR4993

AccessionMI0017859 (change log)
DescriptionGlycine max miR4993 stem-loop
Stem-loop
   -gg  -gc    a    c   g  g     --u  uc 
5'    cg   gaug gcgg ggc gu gagga   ga  c
      ||   |||| |||| ||| || |||||   ||   
3'    gu   uuac cguc uug ua cuucu   cu  c
   gaa  agu    -    -   g  g     ucu  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 26214771-26214840 [-]
intergenic
Database links

Mature sequence gma-miR4993

Accession MIMAT0021011
Sequence

10 - 

gagcggcggcgguggaggaug

 - 30

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).