Stem-loop sequence gma-MIR160c

AccessionMI0017822 (change log)
DescriptionGlycine max miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

20 open access papers mention gma-MIR160c
(59 sentences)

Stem-loop 
   -----------   c       c             ca   c      gg 
5'            ugc uggcucc uguaugccauuug  gag ccauca  a
              ||| ||||||| |||||||||||||  ||| ||||||   
3'            acg accgagg gcgugcgguaagc  uuc gguagu  c
   uugcguguugu   u       a             aa   c      ga
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 43999110-43999200 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR160c
gma-MIR160cchr19: 43999110-43999200 [-]
gma-MIR1535achr19: 43989978-43990073 [+]
gma-MIR1535bchr19: 43989927-43990016 [-]
Database links

Mature sequence gma-miR160c

Accession MIMAT0020971
Sequence

1 -  

ugccuggcucccuguaugcc

 - 20

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
2
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).