Dead miRNA entry

miRNA accession:
MI0017671
miRNA ID:
bfl-mir-4897b
Forward to:
MI0017670
Comment:
Two previously annotated mir-4897 entries map to the same locus in the JGI2.0 genome assembly, and so are merged.

Previous miRNA entry

Stem-loop sequence bfl-mir-4897b

AccessionMI0017671 (change log)
DescriptionBranchiostoma floridae miR-4897b stem-loop
Stem-loop
   -u   c          ga   c c     ug   u   -     u 
5'   gcc acugauuggu  cua c auugg  gcu cca uuagg g
     ||| ||||||||||  ||| | |||||  ||| ||| ||||| g
3'   cgg ugacuaaccg  gau g uagcc  ugg ggu agucu c
   gu   -          uc   a u     gu   u   u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bfl-miR-4897b

Accession MIMAT0020489
Sequence

60 - 

guugccgauugauagcugccaa

 - 81

Get sequence
Evidence experimental;

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).