Stem-loop sequence bfl-mir-4878

AccessionMI0017644 (change log)
DescriptionBranchiostoma floridae miR-4878 stem-loop
Gene family MIPF0001827; mir-4878
Stem-loop
   ugu     a       -  c    u      uuaac 
5'    cccug uuuggag ug agag ggccug     u
      ||||| ||||||| || |||| ||||||      
3'    gggac aaaccuc ac ucuu cuggac     a
   ccc     a       u  a    u      cagac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666612.1: 6167733-6167805 [+]
intergenic
Database links

Mature sequence bfl-miR-4878

Accession MIMAT0020461
Sequence

9 - 

auuuggagugcagaguggccugu

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).