Stem-loop sequence bfl-mir-193b

AccessionMI0017628 (change log)
DescriptionBranchiostoma floridae miR-193b stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
   a u        g       ug        c  u    a 
5'  c ugugaaca ugacuug  gggucagu gg agaa g
    | |||||||| |||||||  |||||||| || |||| a
3'  g acacuugu gcugaac  uccgguca cc uuuu g
   a u        g       ug        u  -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666484.1: 4032844-4032921 [-]
intergenic
Database links

Mature sequence bfl-miR-193b

Accession MIMAT0020111
Sequence

49 - 

uacuggccugucaagucggugu

 - 70

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).