Stem-loop sequence bfl-mir-182b

AccessionMI0017608 (change log)
DescriptionBranchiostoma floridae miR-182b stem-loop
Gene family MIPF0000116; mir-182
Stem-loop
   gga             c   u a        ------    uu  u     g 
5'    cuaguuuucuugg acu g ggaauucu      cugu  gg ugcau u
      ||||||||||||| ||| | ||||||||      ||||  || ||||| a
3'    ggucaaaggaacc uga c ccuuaaga      ggua  uc acgug a
   uug             a   c -        cacuau    uu  u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666785.1: 120014-120113 [-]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-182b
bfl-mir-182aGG666785.1: 120315-120415 [-]
bfl-mir-182bGG666785.1: 120014-120113 [-]
Database links

Mature sequence bfl-miR-182b-3p

Accession MIMAT0020081
Previous IDsbfl-miR-182b*
Sequence

70 - 

cagaauuccccaguaccaaggaa

 - 92

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).