Stem-loop sequence sko-mir-4832

AccessionMI0017576 (change log)
DescriptionSaccoglossus kowalevskii miR-4832 stem-loop
Stem-loop
   cca   c     --   a         c    ac  u   a 
5'    aca caggc  acg caaguugac uuuu  cc uga c
      ||| |||||  ||| ||||||||| ||||  || ||| a
3'    ugu guccg  ugc guucaacug aaga  gg acu u
   acg   u     uu   c         a    cu  u   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Skow_1.1; GCA_000003605.1) Overlapping transcripts
GL010949.1: 354335-354417 [+]
intergenic
Clustered miRNAs
< 10kb from sko-mir-4832
sko-mir-4843GL010949.1: 353783-353873 [+]
sko-mir-4832GL010949.1: 354335-354417 [+]
Database links

Mature sequence sko-miR-4832

Accession MIMAT0020046
Sequence

50 - 

ucagaaagucaacuugccguuugc

 - 73

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21210939 "microRNA complements in deuterostomes: origin and evolution of microRNAs" Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M Evol Dev. 13:15-27(2011).