Stem-loop sequence hsa-mir-4785

AccessionMI0017430 (change log)
Symbol HGNC:MIR4785
DescriptionHomo sapiens miR-4785 stem-loop
Literature search

1 open access papers mention hsa-mir-4785
(1 sentences)

Stem-loop 
   guag      -ac      g     -   cu   - u 
5'     gugggg   gcggcg cgcug cuc  ccg c g
       ||||||   |||||| ||||| |||  ||| |  
3'     cgccuc   cgccgc gcggc gag  ggc g c
   cgcg      gac      a     u   ag   c c
Get sequence
Deep sequencing
409 reads, 0 reads per million, 95 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 160407810-160407882 [-]
sense
OTTHUMT00000333333 ; BAZ2B-004; intron 1
OTTHUMT00000255038 ; BAZ2B-002; intron 2
OTTHUMT00000255037 ; BAZ2B-001; intron 2
OTTHUMT00000406841 ; BAZ2B-015; intron 2
OTTHUMT00000333684 ; BAZ2B-014; intron 2
OTTHUMT00000333334 ; BAZ2B-005; intron 2
ENST00000467184 ; BAZ2B-004; intron 1
ENST00000392782 ; BAZ2B-002; intron 2
ENST00000392783 ; BAZ2B-001; intron 2
ENST00000541068 ; BAZ2B-015; intron 2
ENST00000437839 ; BAZ2B-014; intron 2
ENST00000483316 ; BAZ2B-005; intron 2
ENST00000355831 ; BAZ2B-202; intron 2
ENST00000343439 ; BAZ2B-201; intron 2
Database links

Mature sequence hsa-miR-4785

Accession MIMAT0019949
Sequence

44 -  

agagucggcgacgccgccagc

 - 64

Get sequence
Deep sequencing373 reads, 87 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).