Stem-loop sequence hsa-mir-4776-2

Accession

MI0017420 (change log)

Symbol

HGNC:MIR4776-2

Description

Homo sapiens miR-4776-2 stem-loop

Gene family

MIPF0001210; mir-4776

Stem-loop

                                    a   uc 
5' cuauaugcaguggaccaggauggcaagggcucu cug  c
   ||||||||||||||||||||||||||||||||| |||   
3' gauauacgucaccugguccuaccguucccgaga gac  u
                                    g   uu 

Deep sequencing

67 reads, 114 reads per million, 28 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 212926257-212926336 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000256597 ; ERBB4-001; intron 2

  OTTHUMT00000336976 ; ERBB4-002; intron 2

  OTTHUMT00000336977 ; ERBB4-003; intron 2

  OTTHUMT00000336978 ; ERBB4-004; intron 2

  OTTHUMT00000336979 ; ERBB4-005; intron 2

  ENST00000342788 ; ERBB4-001; intron 2

  ENST00000436443 ; ERBB4-002; intron 2

  ENST00000484594 ; ERBB4-003; intron 2

  ENST00000260943 ; ERBB4-004; intron 2

  ENST00000435846 ; ERBB4-005; intron 2

  ENST00000402597 ; ERBB4-201; intron 2

Clustered miRNAs

< 10kb from hsa-mir-4776-2

• hsa-mir-4776-2: chr2: 212926257-212926336 [-]
• hsa-mir-4776-1: chr2: 212926257-212926336 [+]

Database links

• EntrezGene:MIR4776-2
• HGNC:MIR4776-2
• RNAcentral:URS000075D852_9606
• miRBase Tracker:MI0017420

Mature sequence hsa-miR-4776-5p

• Accession: MIMAT0019932
• Sequence: 10 - guggaccaggauggcaagggcu - 31
• Deep sequencing: 98 reads, 21 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS00001C978C_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4776-5p
  • TargetScanVert:hsa-miR-4776-5p
  • miRDB:hsa-miR-4776-5p

Mature sequence hsa-miR-4776-3p

• Accession: MIMAT0019933
• Sequence: 54 - cuugccauccugguccacugcau - 76
• Deep sequencing: 18 reads, 5 experiments
• Evidence: experimental; Illumina [1]
• Database links:
  • RNAcentral:URS0000396F65_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4776-3p
  • TargetScanVert:hsa-miR-4776-3p
  • miRDB:hsa-miR-4776-3p

References

1. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).