![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4728 |
|||||
Accession | MI0017365 (change log) | ||||
Symbol | HGNC:MIR4728 | ||||
Description | Homo sapiens miR-4728 stem-loop | ||||
Literature search |
![]()
13 open access papers mention hsa-mir-4728 | ||||
Stem-loop |
-- u - a - a ---aca 5' g ggg agggg gagg cagca gc cagg | ||| ||||| |||| ||||| || ||| g 3' c ccc uccuc cucc gucgu cg gucc ga - g c a a aucagg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4728-5p |
|
Accession | MIMAT0019849 |
Sequence |
2 - ugggaggggagaggcagcaagca - 24 |
Deep sequencing | 42 reads, 27 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
Mature sequence hsa-miR-4728-3p |
|
Accession | MIMAT0019850 |
Sequence |
43 - caugcugaccucccuccugccccag - 67 |
Deep sequencing | 98 reads, 61 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|