Stem-loop sequence hsa-mir-4647

AccessionMI0017274 (change log)
Symbol HGNC:MIR4647
DescriptionHomo sapiens miR-4647 stem-loop
Literature search

1 open access papers mention hsa-mir-4647
(1 sentences)

Stem-loop 
          g   -a  a     cu      a  aaa    aug 
5' ccaggag gug  ag uggug  gugcug gg   gggg   c
   ||||||| |||  || |||||  |||||| ||   ||||    
3' gguccuc uau  uc accac  cacgac cc   uccc   a
          g   cc  c     --      -  --g    gag
Get sequence
Deep sequencing
587 reads, 5.26 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 44254206-44254285 [-]
sense
OTTHUMT00000040736 ; TCTE1-001; exon 3
ENST00000371505 ; TCTE1-001; exon 3
ENST00000371503 ; TCTE1-201; 5'UTR (exon 3)
antisense
OTTHUMT00000470403 ; RP11-444E17.6-001; intron 1
OTTHUMT00000470401 ; TMEM151B-003; intron 2
ENST00000505802 ; RP11-444E17.6-001; intron 1
ENST00000438774 ; TMEM151B-003; intron 2
Database links

Mature sequence hsa-miR-4647

Accession MIMAT0019709
Sequence

11 -  

gaagauggugcugugcugaggaa

 - 33

Get sequence
Deep sequencing489 reads, 49 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).