![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence oar-mir-323c |
||||||||||||||||||||||||||
Accession | MI0016962 (change log) | |||||||||||||||||||||||||
Description | Ovis aries miR-323c stem-loop | |||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||
Literature search |
2 open access papers mention oar-mir-323c | |||||||||||||||||||||||||
Stem-loop |
gcgugcugcugcacu u c gccg u - u 5' ugaugcu gaggagagguug ccgug gu cg cau c ||||||| |||||||||||| ||||| || || ||| u 3' acuaugg cuucucuccggc ggcac ca gc gua u -acguuccacccuaa - u auaa c u c |
|||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||
Database links |
|
Mature sequence oar-miR-323c |
|
Accession | MIMAT0019335 |
Sequence |
65 - cacaauacacggucggccucu - 85 |
Deep sequencing | 669 reads, 13 experiments |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:20944086
"Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing"
Genome Res. 20:1651-1662(2010).
|