![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4501 |
|||||
Accession | MI0016864 (change log) | ||||
Symbol | HGNC:MIR4501 | ||||
Description | Homo sapiens miR-4501 stem-loop | ||||
Literature search |
3 open access papers mention hsa-mir-4501 | ||||
Stem-loop |
--u c g uc u auaug 5' augugac uc gaugaa ac gaa u ||||||| || |||||| || ||| 3' uacacug ag cuacuu ug cuu c uuu u a -- u cgagu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-4501 |
|
Accession | MIMAT0019037 |
Sequence |
1 - uaugugaccucggaugaauca - 21 |
Deep sequencing | 31 reads, 18 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|