![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3689e |
||||||||||||||||
Accession | MI0016836 (change log) | |||||||||||||||
Symbol | HGNC:MIR3689E | |||||||||||||||
Description | Homo sapiens miR-3689e stem-loop | |||||||||||||||
Gene family | MIPF0001144; mir-3689 | |||||||||||||||
Stem-loop |
- g ug au g ug g a 5' ggga g ug aucaug uucc ggag uaug u |||| | || |||||| |||| |||| |||| 3' cccu c gc uagugu gagg ccuu gugc a u - gu cc g gu g u |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
Mature sequence hsa-miR-3689e |
|
Accession | MIMAT0019009 |
Sequence |
7 - ugugauaucaugguuccuggga - 28 |
Deep sequencing | 116 reads, 13 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|