Stem-loop sequence hsa-mir-4433a

Accession

MI0016773 (change log)

Previous IDs

hsa-mir-4433

Symbol

HGNC:MIR4433A

Description

Homo sapiens miR-4433a stem-loop

Gene family

MIPF0001826; mir-4433

Literature search

2 open access papers mention hsa-mir-4433a
(2 sentences)

Stem-loop

   c          c           c         uc   uga 
5'  auccuccuua gucccaccccc acuccuguu  ugg   a
    |||||||||| ||||||||||| |||||||||  |||    
3'  uaggaggaau caggguggggg ugaggacaa  acu   a
   a          a           -         --   uau 

Deep sequencing

118 reads, 5.45 reads per million, 55 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr2: 64340759-64340839 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000251686 ; PELI1-001; intron 1

  OTTHUMT00000327082 ; PELI1-004; intron 1

  OTTHUMT00000327080 ; PELI1-002; intron 1

  OTTHUMT00000327081 ; PELI1-003; intron 2

  ENST00000358912 ; PELI1-001; intron 1

  ENST00000466177 ; PELI1-004; intron 1

  ENST00000494203 ; PELI1-002; intron 1

  ENST00000468869 ; PELI1-003; intron 2

Clustered miRNAs

< 10kb from hsa-mir-4433a

• hsa-mir-4433b: chr2: 64340747-64340848 [-]
• hsa-mir-4433a: chr2: 64340759-64340839 [+]

Database links

• EntrezGene:MIR4433
• HGNC:MIR4433A
• miRBase Tracker:MI0016773

Mature sequence hsa-miR-4433a-5p

• Accession: MIMAT0020956
• Previous IDs: hsa-miR-4433-5p
• Sequence: 12 - cgucccaccccccacuccugu - 32
• Deep sequencing: 72 reads, 45 experiments
• Evidence: not experimental
• Predicted targets:
  • TargetScanVert:hsa-miR-4433a-5p
  • miRDB:hsa-miR-4433a-5p

Mature sequence hsa-miR-4433a-3p

• Accession: MIMAT0018949
• Previous IDs: hsa-miR-4433-3p
• Sequence: 51 - acaggagugggggugggacau - 71
• Deep sequencing: 45 reads, 26 experiments
• Evidence: experimental; Illumina [1]
• Predicted targets:
  • TargetScanVert:hsa-miR-4433a-3p
  • miRDB:hsa-miR-4433a-3p

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2. PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).