![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-4433a |
||||||
Accession | MI0016773 (change log) | |||||
Previous IDs | hsa-mir-4433 | |||||
Symbol | HGNC:MIR4433A | |||||
Description | Homo sapiens miR-4433a stem-loop | |||||
Gene family | MIPF0001826; mir-4433 | |||||
Literature search |
2 open access papers mention hsa-mir-4433a | |||||
Stem-loop |
c c c uc uga 5' auccuccuua gucccaccccc acuccuguu ugg a |||||||||| ||||||||||| ||||||||| ||| 3' uaggaggaau caggguggggg ugaggacaa acu a a a - -- uau |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence hsa-miR-4433a-5p |
|
Accession | MIMAT0020956 |
Previous IDs | hsa-miR-4433-5p |
Sequence |
12 - cgucccaccccccacuccugu - 32 |
Deep sequencing | 72 reads, 45 experiments |
Evidence | not experimental |
Predicted targets |
|
Mature sequence hsa-miR-4433a-3p |
|
Accession | MIMAT0018949 |
Previous IDs | hsa-miR-4433-3p |
Sequence |
51 - acaggagugggggugggacau - 71 |
Deep sequencing | 45 reads, 26 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|
2 |
PMID:21558790
"Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis"
RNA Biol. 8:378-383(2011).
|