Stem-loop sequence hsa-mir-4423

Accession

MI0016760 (change log)

Symbol

HGNC:MIR4423

Description

Homo sapiens miR-4423 stem-loop

Gene family

MIPF0001587; mir-4423

Literature search

5 open access papers mention hsa-mir-4423
(19 sentences)

Stem-loop

   a          ca     c      -uu  c      uuu 
5'  ucauguacug  guugc uuuuug   cc augcug   a
    ||||||||||  ||||| ||||||   || ||||||    
3'  aguguaugac  caacg aaaaac   gg uacgau   a
   a          aa     -      cac  a      ccg 

Deep sequencing

1203 reads, 10.2 reads per million, 98 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 85133794-85133873 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000468713 ; SSX2IP-009; intron 1

  OTTHUMT00000027471 ; SSX2IP-003; intron 2

  OTTHUMT00000468712 ; SSX2IP-008; intron 3

  OTTHUMT00000027469 ; SSX2IP-001; intron 4

  OTTHUMT00000092675 ; SSX2IP-006; intron 4

  OTTHUMT00000092676 ; SSX2IP-007; intron 4

  OTTHUMT00000027470 ; SSX2IP-002; intron 5

  ENST00000603677 ; SSX2IP-009; intron 1

  ENST00000460500 ; SSX2IP-003; intron 2

  ENST00000605755 ; SSX2IP-008; intron 3

  ENST00000437941 ; SSX2IP-202; intron 3

  ENST00000342203 ; SSX2IP-001; intron 4

  ENST00000481102 ; SSX2IP-006; intron 4

  ENST00000422026 ; SSX2IP-007; intron 4

  ENST00000370612 ; SSX2IP-201; intron 4

  ENST00000476905 ; SSX2IP-002; intron 5

Database links

• EntrezGene:MIR4423
• HGNC:MIR4423
• RNAcentral:URS000075CEC2_9606
• miRBase Tracker:MI0016760

Mature sequence hsa-miR-4423-5p

• Accession: MIMAT0019232
• Sequence: 13 - aguugccuuuuuguucccaugc - 34
• Deep sequencing: 566 reads, 67 experiments
• Evidence: experimental; Illumina [2,4]
• Database links:
  • RNAcentral:URS0000567AB1_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4423-5p
  • TargetScanVert:hsa-miR-4423-5p
  • miRDB:hsa-miR-4423-5p

Mature sequence hsa-miR-4423-3p

• Accession: MIMAT0018936
• Sequence: 49 - auaggcaccaaaaagcaacaa - 69
• Deep sequencing: 635 reads, 74 experiments
• Evidence: experimental; Illumina [1-2,4]
• Database links:
  • RNAcentral:URS00001481F9_9606
• Predicted targets:
  • TargetMiner:hsa-miR-4423-3p
  • TargetScanVert:hsa-miR-4423-3p
  • miRDB:hsa-miR-4423-3p

References

1. PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3. PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
4. PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).
5. PMID:24158479 "MicroRNA 4423 is a primate-specific regulator of airway epithelial cell differentiation and lung carcinogenesis" Perdomo C, Campbell JD, Gerrein J, Tellez CS, Garrison CB, Walser TC, Drizik E, Si H, Gower AC, Vick J, Anderlind C, Jackson GR, Mankus C, Schembri F, O'Hara C, Gomperts BN, Dubinett SM, Hayden P, Belinsky SA, Lenburg ME, Spira A Proc Natl Acad Sci U S A. 110:18946-18951(2013).