![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-548h-5 |
|||||
Accession | MI0016751 (change log) | ||||
Symbol | HGNC:MIR548H5 | ||||
Description | Homo sapiens miR-548h-5 stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
43 open access papers mention hsa-mir-548h-5 | ||||
Stem-loop |
a c u - c 5' caaaaguaaucg gguuuuug ca uua u |||||||||||| |||||||| || ||| 3' guuuucguuggc ccaaaaau gu aau u c a - c u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-548h-5p |
|
Accession | MIMAT0005928 |
Previous IDs | hsa-miR-548h |
Sequence |
3 - aaaaguaaucgcgguuuuuguc - 24 |
Deep sequencing | 29178 reads, 146 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20733160
"Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs"
Blood. 116:e118-e127(2010).
|