Stem-loop sequence csi-MIR3954

AccessionMI0016739 (change log)
DescriptionCitrus sinensis miR3954 stem-loop
Literature search

2 open access papers mention csi-MIR3954
(3 sentences)

Stem-loop
   --------------------------------------------------uuu         gaca  g 
5'                                                      acuuggcug    ga a
                                                        |||||||||    ||  
3'                                                      ugaacuggc    cu a
   aagguagguggucuacuucuucuuuaguaguuagcaaaggacuuguucuucuc         ---a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 20108227-20108313 [-]
intergenic
Database links

Mature sequence csi-miR3954

Accession MIMAT0018497
Sequence

11 - 

uggacagagaaaucacgguca

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).