![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR3954 |
|||||
Accession | MI0016739 (change log) | ||||
Description | Citrus sinensis miR3954 stem-loop | ||||
Literature search |
2 open access papers mention csi-MIR3954 | ||||
Stem-loop |
--------------------------------------------------uuu gaca g 5' acuuggcug ga a ||||||||| || 3' ugaacuggc cu a aagguagguggucuacuucuucuuuaguaguuagcaaaggacuuguucuucuc ---a a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR3954 |
|
Accession | MIMAT0018497 |
Sequence |
11 - uggacagagaaaucacgguca - 31 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|