Stem-loop sequence csi-MIR3953

AccessionMI0016738 (change log)
DescriptionCitrus sinensis miR3953 stem-loop
Literature search

1 open access papers mention csi-MIR3953
(1 sentences)

Stem-loop
   u  --au  uc     a  -       c   acaga    ucauucc u  au 
5'  gg    aa  ugaug cu gcagagc cag     ggcg       g gc  c
    ||    ||  ||||| || ||||||| |||     ||||       | ||   
3'  cc    uu  gcugc ga cgucuug guu     cugc       c cg  a
   u  gucu  ga     c  a       a   ---ag    cccacua -  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 20081221-20081321 [-]
intergenic
Database links

Mature sequence csi-miR3953

Accession MIMAT0018496
Sequence

71 - 

uugaguucugcaagccgucga

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).