Stem-loop sequence csi-MIR482c

AccessionMI0016737 (change log)
DescriptionCitrus sinensis miR482c stem-loop
Gene family MIPF0000403; MIR482
Literature search

5 open access papers mention csi-MIR482c
(7 sentences)

Stem-loop
   u      uuu     -u   ug            ----uu   -    uu 
5'  aaaauu   ggaau  ggg  cuagggaagguu      guu ugac  g
    ||||||   |||||  |||  ||||||||||||      ||| ||||   
3'  uuuuag   ccuua  ccc  gaucccuuuuaa      caa acug  u
   c      uau     uc   cu            uuaaau   u    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 9927230-9927325 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR482c
csi-MIR482echr2: 9926991-9927153 [+]
csi-MIR482cchr2: 9927230-9927325 [+]
csi-MIR482bchr2: 9932506-9932614 [+]
Database links

Mature sequence csi-miR482c-5p

Accession MIMAT0037416
Sequence

11 - 

ggaauugggugcuagggaagg

 - 31

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR482c-3p

Accession MIMAT0018495
Sequence

67 - 

uucccuagucccccuauuccua

 - 88

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).