Stem-loop sequence csi-MIR3952

AccessionMI0016736 (change log)
DescriptionCitrus sinensis miR3952 stem-loop
Stem-loop
   uauuc     u     g    u            cuc      c   ccauggacugggagcgaaggaagugggaucugau 
5'      uuuca gugcu uaga aggcccuucaac   ggaaac uca                                  g
        ||||| ||||| |||| ||||||||||||   |||||| |||                                   
3'      aaggu cacga aucu uccgggaaguug   cuuuug agu                                  g
   uaccu     -     g    u            aaa      c   agaaagaaaacgucgaacgguggauguuacgguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr8: 16164905-16165067 [+]
intergenic
Database links

Mature sequence csi-miR3952-5p

Accession MIMAT0037415
Sequence

14 - 

gcuguagauaggcccuucaac

 - 34

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR3952-3p

Accession MIMAT0018494
Sequence

133 - 

ugaagggccuuucuagagcac

 - 153

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).