Stem-loop sequence csi-MIR3951a

AccessionMI0016734 (change log)
DescriptionCitrus sinensis miR3951a stem-loop
Literature search

1 open access papers mention csi-MIR3951a
(3 sentences)

Stem-loop
   -cau            u           a             uau       -   u      aauuuguucccu 
5'     aagaggagugcu ggcauagauaa gaugagagaaaaa   gagagaa aga gagaga            c
       |||||||||||| ||||||||||| |||||||||||||   ||||||| ||| ||||||             
3'     uucuuuuuacga ucgugucuauu cuauucucuuuuu   uucuuuu ucu cucucu            u
   uagc            u           g             --c       c   u      cacccacccaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr4: 7896098-7896245 [-]
intergenic
Database links

Mature sequence csi-miR3951a-5p

Accession MIMAT0018492
Sequence

21 - 

uagauaaagaugagagaaaaa

 - 41

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR3951a-3p

Accession MIMAT0037414
Sequence

109 - 

uuucucuuaucguuaucugu

 - 128

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).