Stem-loop sequence csi-MIR482b

AccessionMI0016723 (change log)
DescriptionCitrus sinensis miR482b stem-loop
Gene family MIPF0000403; MIR482
Literature search

4 open access papers mention csi-MIR482b
(6 sentences)

Stem-loop
   a        cu           -cuu         cgaucua        guuc 
5'  ggaaauuu  ggaaugggagg    ggcaagaag       uuuuucuu    a
    ||||||||  |||||||||||    |||||||||       ||||||||    a
3'  ccuuuagg  ccuuacccucc    ccguucuuu       aaaaagaa    u
   -        uu           ccac         uuaaaag        aaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 9932506-9932614 [+]
intergenic
Clustered miRNAs
< 10kb from csi-MIR482b
csi-MIR482echr2: 9926991-9927153 [+]
csi-MIR482cchr2: 9927230-9927325 [+]
csi-MIR482bchr2: 9932506-9932614 [+]
csi-MIR482achr2: 9941395-9941523 [+]
Database links

Mature sequence csi-miR482b-5p

Accession MIMAT0037411
Sequence

14 - 

aaugggaggcuuggcaagaag

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR482b-3p

Accession MIMAT0018481
Sequence

78 - 

ucuugcccaccccucccauucc

 - 99

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).