Stem-loop sequence csi-MIR408

AccessionMI0016715 (change log)
DescriptionCitrus sinensis miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

3 open access papers mention csi-MIR408
(13 sentences)

Stem-loop
   agguaauaauaacucuuuggugugugcgugagagaga  c   aa   a    caaaaga       c      a      au   a   uu     g 
5'                                      gg aag  gca gaga       cggggaa aggcag gcaugg  gga cca  aacag u
                                        || |||  ||| ||||       ||||||| |||||| ||||||  ||| |||  ||||| u
3'                                      cc uuc  cgu cucu       gucccuu uccguc cguacc  ccu ggu  uuguc c
   ------------------------------------u  -   --   -    -----cg       c      a      cu   c   -u     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999133.1: 795393-795545 [-]
intergenic
Database links

Mature sequence csi-miR408-5p

Accession MIMAT0037406
Sequence

60 - 

acggggaacaggcagagcaug

 - 80

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR408-3p

Accession MIMAT0018472
Sequence

120 - 

augcacugccucuucccuggc

 - 140

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).