Stem-loop sequence csi-MIR399d

AccessionMI0016711 (change log)
DescriptionCitrus sinensis miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention csi-MIR399d
(12 sentences)

Stem-loop
   a        u       c     ac        -  a   u    uauuggugcaauaaucagca 
5'  aagcaguu uagggca cucuu  uuggcaug ca ugg gauu                    u
    |||||||| ||||||| |||||  |||||||| || ||| ||||                     
3'  uucgucag gucccgu gagag  aaccguau gu acc cuaa                    u
   c        u       u     ga        a  c   -    cuauagcuuaauugguuaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr9: 15383353-15383482 [+]
intergenic
Database links

Mature sequence csi-miR399d-5p

Accession MIMAT0037402
Sequence

13 - 

gggcaccucuuacuuggcaug

 - 33

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR399d-3p

Accession MIMAT0018468
Sequence

100 - 

ugccaaaggagaguugcccug

 - 120

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).