![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR399d |
|||||
Accession | MI0016711 (change log) | ||||
Description | Citrus sinensis miR399d stem-loop | ||||
Gene family | MIPF0000015; MIR399 | ||||
Literature search |
![]()
4 open access papers mention csi-MIR399d | ||||
Stem-loop |
a u c ac - a u uauuggugcaauaaucagca 5' aagcaguu uagggca cucuu uuggcaug ca ugg gauu u |||||||| ||||||| ||||| |||||||| || ||| |||| 3' uucgucag gucccgu gagag aaccguau gu acc cuaa u c u u ga a c - cuauagcuuaauugguuaua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR399d-5p |
|
Accession | MIMAT0037402 |
Sequence |
13 - gggcaccucuuacuuggcaug - 33 |
Evidence | experimental; Illumina [2] |
Mature sequence csi-miR399d-3p |
|
Accession | MIMAT0018468 |
Sequence |
100 - ugccaaaggagaguugcccug - 120 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
2 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|