Stem-loop sequence csi-MIR399c

AccessionMI0016710 (change log)
DescriptionCitrus sinensis miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention csi-MIR399c
(12 sentences)

Stem-loop
   ucaauacaaagugacaa     uu   -    aa   u     c           u     ---u      -----        g 
5'                  ugugg  gag gaau  cag gcagu cuccuuuggcg gcaga    ugcaaa     gagauaau c
                    |||||  ||| ||||  ||| ||||| ||||||||||| |||||    ||||||     ||||||||  
3'                  acgcu  cuc cuua  guc cguua gaggaaaccgu ugucu    acguuu     cuuuauua a
   ------------gaucg     --   a    cc   c     a           u     uccu      acuua        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 2303898-2304046 [-]
intergenic
Clustered miRNAs
< 10kb from csi-MIR399c
csi-MIR399echr2: 2305516-2305646 [+]
csi-MIR399cchr2: 2303898-2304046 [-]
csi-MIR399fchr2: 2298474-2298644 [-]
Database links

Mature sequence csi-miR399c-5p

Accession MIMAT0037401
Sequence

36 - 

gugcaguccuccuuuggcgug

 - 56

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR399c-3p

Accession MIMAT0018467
Sequence

109 - 

ugccaaaggagaauugcccug

 - 129

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).