![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR397 |
|||||
Accession | MI0016708 (change log) | ||||
Description | Citrus sinensis miR397 stem-loop | ||||
Gene family | MIPF0000120; MIR397 | ||||
Literature search |
![]()
5 open access papers mention csi-MIR397 | ||||
Stem-loop |
--------------------------- auu --- c a uauuu -g u uugccaaua 5' ccag ga aaaaaacau auugagugcagcguug ugaa guc g gcu u |||| || ||||||||| |||||||||||||||| |||| ||| | ||| u 3' gguc cu uuuuuugua uagcucacgucgcgac acuu uag c cga u acacgcauaauagaccuauuaggacuu -gu cga c c --ucu ga - ucauaucuc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR397-5p |
|
Accession | MIMAT0018465 |
Sequence |
18 - ucauugagugcagcguugaug - 38 |
Evidence | experimental; Illumina [1-2] |
Mature sequence csi-miR397-3p |
|
Accession | MIMAT0037400 |
Sequence |
91 - accagcgcugcacucgaucau - 111 |
Evidence | experimental; Illumina [2] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
2 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|