Stem-loop sequence csi-MIR397

AccessionMI0016708 (change log)
DescriptionCitrus sinensis miR397 stem-loop
Gene family MIPF0000120; MIR397
Literature search

5 open access papers mention csi-MIR397
(10 sentences)

Stem-loop
   ---------------------------    auu  ---         c                a    uauuu   -g u   uugccaaua 
5'                            ccag   ga   aaaaaacau auugagugcagcguug ugaa     guc  g gcu         u
                              ||||   ||   ||||||||| |||||||||||||||| ||||     |||  | |||         u
3'                            gguc   cu   uuuuuugua uagcucacgucgcgac acuu     uag  c cga         u
   acacgcauaauagaccuauuaggacuu    -gu  cga         c                c    --ucu   ga -   ucauaucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 4101151-4101306 [-]
intergenic
Database links

Mature sequence csi-miR397-5p

Accession MIMAT0018465
Sequence

18 - 

ucauugagugcagcguugaug

 - 38

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR397-3p

Accession MIMAT0037400
Sequence

91 - 

accagcgcugcacucgaucau

 - 111

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).