![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR395a |
|||||
Accession | MI0016705 (change log) | ||||
Description | Citrus sinensis miR395a stem-loop | ||||
Gene family | MIPF0000016; MIR395 | ||||
Literature search |
![]()
4 open access papers mention csi-MIR395a | ||||
Stem-loop |
- u u g u u cuaua -c a 5' ug c cc ggaguuccuccga cacuuca ugggg ugau auuu g || | || ||||||||||||| ||||||| ||||| |||| |||| a 3' ac g gg ucucaaggggguu gugaagu acccc acug uaaa g c c u g u c ----- uu a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR395a |
|
Accession | MIMAT0018462 |
Sequence |
70 - cugaaguguuugggggaacuc - 90 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
2 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|