Stem-loop sequence csi-MIR395a

AccessionMI0016705 (change log)
DescriptionCitrus sinensis miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

4 open access papers mention csi-MIR395a
(31 sentences)

Stem-loop
   -  u u  g             u       u     cuaua    -c    a 
5'  ug c cc ggaguuccuccga cacuuca ugggg     ugau  auuu g
    || | || ||||||||||||| ||||||| |||||     ||||  |||| a
3'  ac g gg ucucaaggggguu gugaagu acccc     acug  uaaa g
   c  c u  g             u       c     -----    uu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr5: 25578967-25579066 [-]
intergenic
Database links

Mature sequence csi-miR395a

Accession MIMAT0018462
Sequence

70 - 

cugaaguguuugggggaacuc

 - 90

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).