Stem-loop sequence csi-MIR172c

AccessionMI0016701 (change log)
DescriptionCitrus sinensis miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

5 open access papers mention csi-MIR172c
(15 sentences)

Stem-loop
   ------------   gu    a    g    c           a    c  uu     -uag   -      a   u  u     uuuua 
5'             acu  uugc guug agca caucaagauuc caaa ua  agggu    uga guggag uaa gg ggcua     u
               |||  |||| |||| |||| ||||||||||| |||| ||  |||||    ||| |||||| ||| || |||||      
3'             uga  agcg cgac ucgu guaguucuaag guuu gu  ucucg    acu cacuuc guu cc ccggu     u
   auauuaaaucgg   au    a    g    a           -    u  -u     uuaa   u      -   -  -     uuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr7: 31488799-31488961 [+]
intergenic
Database links

Mature sequence csi-miR172c-5p

Accession MIMAT0037397
Sequence

14 - 

ggagcaccaucaagauucaca

 - 34

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR172c-3p

Accession MIMAT0018458
Sequence

119 - 

uggaaucuugaugaugcugcag

 - 140

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).