Stem-loop sequence csi-MIR171a

AccessionMI0016699 (change log)
DescriptionCitrus sinensis miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

3 open access papers mention csi-MIR171a
(3 sentences)

Stem-loop 
   --uaca   g        ug         a     a   u      ua 
5'       acg gauauugg  cgguucaau agaaa cgg gcucaa  c
         ||| ||||||||  ||||||||| ||||| ||| ||||||   
3'       ugc cuauaacc  gccgaguua uuuuu gcc cgaguu  u
   ucaccg   a        gu         g     c   u      uu
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 18395485-18395580 [+]
intergenic
Database links

Mature sequence csi-miR171a

Accession MIMAT0018456
Sequence

69 -  

uugagccgugccaauaucac

 - 88

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).