![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR171a |
|||||
Accession | MI0016699 (change log) | ||||
Description | Citrus sinensis miR171a stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
3 open access papers mention csi-MIR171a | ||||
Stem-loop |
--uaca g ug a a u ua 5' acg gauauugg cgguucaau agaaa cgg gcucaa c ||| |||||||| ||||||||| ||||| ||| |||||| 3' ugc cuauaacc gccgaguua uuuuu gcc cgaguu u ucaccg a gu g c u uu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR171a |
|
Accession | MIMAT0018456 |
Sequence |
69 - uugagccgugccaauaucac - 88 |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
2 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|