Stem-loop sequence csi-MIR171b

AccessionMI0016698 (change log)
DescriptionCitrus sinensis miR171b stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

3 open access papers mention csi-MIR171b
(3 sentences)

Stem-loop
   cauggagagcaaaagcaccuucuugg   uu   -      g   u  u                  a   uaauuaau    ua    ----uuc    c 
5'                           cga  gga gaagua aca gg gugauauugguucggcuc ucu        agau  auau       agcc u
                             |||  ||| |||||| ||| || |||||||||||||||||| |||        ||||  ||||       |||| u
3'                           guu  cuu cuucgu ugu uc cacuauaacuaagccgag aga        ucua  uaug       uugg a
   -----------------------uua   uu   u      a   -  u                  c   --------    ua    uacauuc    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999127.1: 105690-105857 [+]
intergenic
Database links

Mature sequence csi-miR171b-5p

Accession MIMAT0037396
Sequence

48 - 

ugugauauugguucggcucauc

 - 69

Get sequence
Evidence experimental; Illumina [2]

Mature sequence csi-miR171b-3p

Accession MIMAT0018455
Sequence

125 - 

cgagccgaaucaauaucacuc

 - 145

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).