Stem-loop sequence csi-MIR167b

AccessionMI0016697 (change log)
DescriptionCitrus sinensis miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

4 open access papers mention csi-MIR167b
(5 sentences)

Stem-loop
   -------------a   g   -   - uau   a          a         -  a u      cuu 
5'               ucg gca cca c   cag ugaagcugcc gcaugaucu ua c uuccuc   u
                 ||| ||| ||| |   ||| |||||||||| ||||||||| || | ||||||    
3'               agc cgu ggu g   guc acuuugacgg cguacuaga au g aaggag   g
   gaccugagcauuaa   a   u   u cuu   c          -         c  a u      cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr9: 4850348-4850470 [+]
intergenic
Database links

Mature sequence csi-miR167b-5p

Accession MIMAT0018454
Sequence

20 - 

ugaagcugccagcaugaucuu

 - 40

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR167b-3p

Accession MIMAT0037395
Sequence

71 - 

agaucaugcggcaguuucacc

 - 91

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).