Stem-loop sequence csi-MIR167c

AccessionMI0016696 (change log)
DescriptionCitrus sinensis miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

4 open access papers mention csi-MIR167c
(5 sentences)

Stem-loop
   uuugagagauugaagcugccagcaugaucugguaaucaaccuuuuuguauauauauauauauauuaauuccuuauaguuuuuagauuuaauuucuuuuaauuagauccaugguuucaauucuauugaauaaauggugggguuuuauauuuucgugcaa     -aa    aua      aua       u   uc aa    uuuuuuaguuuuauu        uuu     ccua 
5'                                                                                                                                                               uuauu   gagg   gaugga   gcgccuu aaa  c  ucac               uugaucuu   ugccc    a
                                                                                                                                                                 |||||   ||||   ||||||   ||||||| |||  |  ||||               ||||||||   |||||    a
3'                                                                                                                                                               aguag   cuuc   uuauuu   uguggga uuu  g  agug               aauuggaa   auggg    a
   ----------------------------------------------------------------------------------------------------------------------uuacucauuaacuucgacguucuacuggacuaccuuggua     aug    -ga      -ag       u   ga ag    ------------uau        ---     aauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr2: 8234791-8235131 [+]
intergenic
Database links

Mature sequence csi-miR167c-5p

Accession MIMAT0018453
Sequence

11 - 

ugaagcugccagcaugaucug

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence csi-miR167c-3p

Accession MIMAT0037394
Sequence

313 - 

aggucaucuugcagcuucaau

 - 333

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
2
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).